pentr topo cloning vector (Thermo Fisher)
Thermo Fisher is a verified supplier 
Thermo Fisher manufactures this product 
98
Structured Review
Thermo Fisher
pentr topo cloning vector
Pentr Topo Cloning Vector, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pentr+topo+cloning+vector/KANAMYCIN+SULFATE/pmc12257277-309-24-31
Average 98 stars, based on 1 article reviews
Pentr Topo Cloning Vector, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pentr+topo+cloning+vector/KANAMYCIN+SULFATE/pmc12257277-309-24-31
Average 98 stars, based on 1 article reviews
pentr topo cloning vector - by Bioz Stars,
2026-09
98/100 stars
Images
Related Articles
Clone Assay:Article Title: Splinkerette PCR for Mapping Transposable Elements in Drosophila Article Snippet: .. This gives a band of approximately 8 kb which was cloned into the Article Title: Mitogen-activated protein kinase kinase 5 (MKK5)-mediated signalling cascade regulates expression of iron superoxide dismutase gene in Arabidopsis under salinity stress Article Snippet: .. All cDNAs were amplified by PCR from Arabidopsis (Col-0 or mutants), cloned into the Article Title: Mitogen-activated protein kinase kinase 5 (MKK5)-mediated signalling cascade regulates expression of iron superoxide dismutase gene in Arabidopsis under salinity stress Article Snippet: .. Full-length Arabidopsis MKK5, MPK3, MPK4, and MPK6 cDNAs were obtained using RT-PCR, cloned into the Cloning:Article Title: Splinkerette PCR for Mapping Transposable Elements in Drosophila Article Snippet: .. This gives a band of approximately 8 kb which was cloned into the Article Title: Mitogen-activated protein kinase kinase 5 (MKK5)-mediated signalling cascade regulates expression of iron superoxide dismutase gene in Arabidopsis under salinity stress Article Snippet: .. All cDNAs were amplified by PCR from Arabidopsis (Col-0 or mutants), cloned into the Article Title: Running on empty: Mitochondria without mtDNA exhibit differential motility and connectivity Article Snippet: Plasmid DNA was extracted using a column-free plasmid prep method , and mt-Kaede-HI-NESS-HA was amplified from the plasmid (linearised using AvrII restriction enzyme (NEB, # R0174S) using RP (5’-CAAGAAAGCTGGGTTTAAGCG-3’) and FP2 primers (5’-CACCGCCACCATGTCCGT-3’) resulting in only one cox8 sequence being carried through, and a CACC sequence for directional TOPO cloning being introduced. .. This 1003bp PCR product was extracted from a 1% agarose gel using the TakaraBio gel extraction kit (TakaraBio, #740609.50), and introduced to the Article Title: Sugar Alcohols of Polyol Pathway Serve as Alarmins to Mediate Local-Systemic Innate Immune Communication in Drosophila. Article Snippet: pAFW-PGRP-LC was constructed with Gateway system (Invitrogen). .. The full-length cDNA of PGRP-LC was amplified from w1118 genomic cDNA (the primers listed in Key Resources Table), and then subcloned into Article Title: ( ID ‐ ICPMB05 ) Running on Empty: Mitochondria Without DNA Exhibit Differential Motility and Connectivity Article Snippet: Plasmid DNA was extracted using a column‐free plasmid prep method (Green and Sambrook ), and mt‐Kaede‐HI‐NESS‐HA was amplified from the plasmid (linearised using AvrII restriction enzyme (NEB, # R0174S) using RP (5′‐CAAGAAAGCTGGGTTTAAGCG‐3′) and FP2 primers (5′‐CACCGCCACCATGTCCGT‐3′)) resulting in only one Cox8 sequence being carried through, and a CACC sequence for directional TOPO cloning being introduced. .. This 1003 bp PCR product was extracted from a 1% agarose gel using the TakaraBio gel extraction kit (TakaraBio, #740609.50) and introduced to the Article Title: Mitogen-activated protein kinase kinase 5 (MKK5)-mediated signalling cascade regulates expression of iron superoxide dismutase gene in Arabidopsis under salinity stress Article Snippet: .. Full-length Arabidopsis MKK5, MPK3, MPK4, and MPK6 cDNAs were obtained using RT-PCR, cloned into the Article Title: Bap180/Baf180 is required to maintain homeostasis of intestinal innate immune response in Drosophila and mice. Article Snippet: Immune homeostasis is a prerequisite to protective immunity against gastrointestinal infections.. In Drosophila, immune deficiency (IMD) signalling (tumour necrosis factor receptor/interleukin-1 receptor, TNFR/IL-1R in mammals) is indispensable for intestinal immunity against invading bacteria.. However, how this local antimicrobial immune response contributes to inflammatory regulation remains poorly defined. Plasmid Preparation:Article Title: Splinkerette PCR for Mapping Transposable Elements in Drosophila Article Snippet: .. This gives a band of approximately 8 kb which was cloned into the Article Title: Running on empty: Mitochondria without mtDNA exhibit differential motility and connectivity Article Snippet: Plasmid DNA was extracted using a column-free plasmid prep method , and mt-Kaede-HI-NESS-HA was amplified from the plasmid (linearised using AvrII restriction enzyme (NEB, # R0174S) using RP (5’-CAAGAAAGCTGGGTTTAAGCG-3’) and FP2 primers (5’-CACCGCCACCATGTCCGT-3’) resulting in only one cox8 sequence being carried through, and a CACC sequence for directional TOPO cloning being introduced. .. This 1003bp PCR product was extracted from a 1% agarose gel using the TakaraBio gel extraction kit (TakaraBio, #740609.50), and introduced to the Article Title: Sugar Alcohols of Polyol Pathway Serve as Alarmins to Mediate Local-Systemic Innate Immune Communication in Drosophila. Article Snippet: pAFW-PGRP-LC was constructed with Gateway system (Invitrogen). .. The full-length cDNA of PGRP-LC was amplified from w1118 genomic cDNA (the primers listed in Key Resources Table), and then subcloned into Article Title: ( ID ‐ ICPMB05 ) Running on Empty: Mitochondria Without DNA Exhibit Differential Motility and Connectivity Article Snippet: Plasmid DNA was extracted using a column‐free plasmid prep method (Green and Sambrook ), and mt‐Kaede‐HI‐NESS‐HA was amplified from the plasmid (linearised using AvrII restriction enzyme (NEB, # R0174S) using RP (5′‐CAAGAAAGCTGGGTTTAAGCG‐3′) and FP2 primers (5′‐CACCGCCACCATGTCCGT‐3′)) resulting in only one Cox8 sequence being carried through, and a CACC sequence for directional TOPO cloning being introduced. .. This 1003 bp PCR product was extracted from a 1% agarose gel using the TakaraBio gel extraction kit (TakaraBio, #740609.50) and introduced to the Article Title: Bap180/Baf180 is required to maintain homeostasis of intestinal innate immune response in Drosophila and mice. Article Snippet: Immune homeostasis is a prerequisite to protective immunity against gastrointestinal infections.. In Drosophila, immune deficiency (IMD) signalling (tumour necrosis factor receptor/interleukin-1 receptor, TNFR/IL-1R in mammals) is indispensable for intestinal immunity against invading bacteria.. However, how this local antimicrobial immune response contributes to inflammatory regulation remains poorly defined. Amplification:Article Title: Mitogen-activated protein kinase kinase 5 (MKK5)-mediated signalling cascade regulates expression of iron superoxide dismutase gene in Arabidopsis under salinity stress Article Snippet: .. All cDNAs were amplified by PCR from Arabidopsis (Col-0 or mutants), cloned into the Article Title: Sugar Alcohols of Polyol Pathway Serve as Alarmins to Mediate Local-Systemic Innate Immune Communication in Drosophila. Article Snippet: pAFW-PGRP-LC was constructed with Gateway system (Invitrogen). .. The full-length cDNA of PGRP-LC was amplified from w1118 genomic cDNA (the primers listed in Key Resources Table), and then subcloned into Article Title: Bap180/Baf180 is required to maintain homeostasis of intestinal innate immune response in Drosophila and mice. Article Snippet: Immune homeostasis is a prerequisite to protective immunity against gastrointestinal infections.. In Drosophila, immune deficiency (IMD) signalling (tumour necrosis factor receptor/interleukin-1 receptor, TNFR/IL-1R in mammals) is indispensable for intestinal immunity against invading bacteria.. However, how this local antimicrobial immune response contributes to inflammatory regulation remains poorly defined. Polymerase Chain Reaction:Article Title: Mitogen-activated protein kinase kinase 5 (MKK5)-mediated signalling cascade regulates expression of iron superoxide dismutase gene in Arabidopsis under salinity stress Article Snippet: .. All cDNAs were amplified by PCR from Arabidopsis (Col-0 or mutants), cloned into the Article Title: Running on empty: Mitochondria without mtDNA exhibit differential motility and connectivity Article Snippet: Plasmid DNA was extracted using a column-free plasmid prep method , and mt-Kaede-HI-NESS-HA was amplified from the plasmid (linearised using AvrII restriction enzyme (NEB, # R0174S) using RP (5’-CAAGAAAGCTGGGTTTAAGCG-3’) and FP2 primers (5’-CACCGCCACCATGTCCGT-3’) resulting in only one cox8 sequence being carried through, and a CACC sequence for directional TOPO cloning being introduced. .. This 1003bp PCR product was extracted from a 1% agarose gel using the TakaraBio gel extraction kit (TakaraBio, #740609.50), and introduced to the Article Title: ( ID ‐ ICPMB05 ) Running on Empty: Mitochondria Without DNA Exhibit Differential Motility and Connectivity Article Snippet: Plasmid DNA was extracted using a column‐free plasmid prep method (Green and Sambrook ), and mt‐Kaede‐HI‐NESS‐HA was amplified from the plasmid (linearised using AvrII restriction enzyme (NEB, # R0174S) using RP (5′‐CAAGAAAGCTGGGTTTAAGCG‐3′) and FP2 primers (5′‐CACCGCCACCATGTCCGT‐3′)) resulting in only one Cox8 sequence being carried through, and a CACC sequence for directional TOPO cloning being introduced. .. This 1003 bp PCR product was extracted from a 1% agarose gel using the TakaraBio gel extraction kit (TakaraBio, #740609.50) and introduced to the Sequencing:Article Title: Mitogen-activated protein kinase kinase 5 (MKK5)-mediated signalling cascade regulates expression of iron superoxide dismutase gene in Arabidopsis under salinity stress Article Snippet: .. All cDNAs were amplified by PCR from Arabidopsis (Col-0 or mutants), cloned into the Agarose Gel Electrophoresis:Article Title: Running on empty: Mitochondria without mtDNA exhibit differential motility and connectivity Article Snippet: Plasmid DNA was extracted using a column-free plasmid prep method , and mt-Kaede-HI-NESS-HA was amplified from the plasmid (linearised using AvrII restriction enzyme (NEB, # R0174S) using RP (5’-CAAGAAAGCTGGGTTTAAGCG-3’) and FP2 primers (5’-CACCGCCACCATGTCCGT-3’) resulting in only one cox8 sequence being carried through, and a CACC sequence for directional TOPO cloning being introduced. .. This 1003bp PCR product was extracted from a 1% agarose gel using the TakaraBio gel extraction kit (TakaraBio, #740609.50), and introduced to the Article Title: ( ID ‐ ICPMB05 ) Running on Empty: Mitochondria Without DNA Exhibit Differential Motility and Connectivity Article Snippet: Plasmid DNA was extracted using a column‐free plasmid prep method (Green and Sambrook ), and mt‐Kaede‐HI‐NESS‐HA was amplified from the plasmid (linearised using AvrII restriction enzyme (NEB, # R0174S) using RP (5′‐CAAGAAAGCTGGGTTTAAGCG‐3′) and FP2 primers (5′‐CACCGCCACCATGTCCGT‐3′)) resulting in only one Cox8 sequence being carried through, and a CACC sequence for directional TOPO cloning being introduced. .. This 1003 bp PCR product was extracted from a 1% agarose gel using the TakaraBio gel extraction kit (TakaraBio, #740609.50) and introduced to the Gel Extraction:Article Title: Running on empty: Mitochondria without mtDNA exhibit differential motility and connectivity Article Snippet: Plasmid DNA was extracted using a column-free plasmid prep method , and mt-Kaede-HI-NESS-HA was amplified from the plasmid (linearised using AvrII restriction enzyme (NEB, # R0174S) using RP (5’-CAAGAAAGCTGGGTTTAAGCG-3’) and FP2 primers (5’-CACCGCCACCATGTCCGT-3’) resulting in only one cox8 sequence being carried through, and a CACC sequence for directional TOPO cloning being introduced. .. This 1003bp PCR product was extracted from a 1% agarose gel using the TakaraBio gel extraction kit (TakaraBio, #740609.50), and introduced to the Article Title: ( ID ‐ ICPMB05 ) Running on Empty: Mitochondria Without DNA Exhibit Differential Motility and Connectivity Article Snippet: Plasmid DNA was extracted using a column‐free plasmid prep method (Green and Sambrook ), and mt‐Kaede‐HI‐NESS‐HA was amplified from the plasmid (linearised using AvrII restriction enzyme (NEB, # R0174S) using RP (5′‐CAAGAAAGCTGGGTTTAAGCG‐3′) and FP2 primers (5′‐CACCGCCACCATGTCCGT‐3′)) resulting in only one Cox8 sequence being carried through, and a CACC sequence for directional TOPO cloning being introduced. .. This 1003 bp PCR product was extracted from a 1% agarose gel using the TakaraBio gel extraction kit (TakaraBio, #740609.50) and introduced to the Transformation Assay:Article Title: Running on empty: Mitochondria without mtDNA exhibit differential motility and connectivity Article Snippet: Plasmid DNA was extracted using a column-free plasmid prep method , and mt-Kaede-HI-NESS-HA was amplified from the plasmid (linearised using AvrII restriction enzyme (NEB, # R0174S) using RP (5’-CAAGAAAGCTGGGTTTAAGCG-3’) and FP2 primers (5’-CACCGCCACCATGTCCGT-3’) resulting in only one cox8 sequence being carried through, and a CACC sequence for directional TOPO cloning being introduced. .. This 1003bp PCR product was extracted from a 1% agarose gel using the TakaraBio gel extraction kit (TakaraBio, #740609.50), and introduced to the Article Title: ( ID ‐ ICPMB05 ) Running on Empty: Mitochondria Without DNA Exhibit Differential Motility and Connectivity Article Snippet: Plasmid DNA was extracted using a column‐free plasmid prep method (Green and Sambrook ), and mt‐Kaede‐HI‐NESS‐HA was amplified from the plasmid (linearised using AvrII restriction enzyme (NEB, # R0174S) using RP (5′‐CAAGAAAGCTGGGTTTAAGCG‐3′) and FP2 primers (5′‐CACCGCCACCATGTCCGT‐3′)) resulting in only one Cox8 sequence being carried through, and a CACC sequence for directional TOPO cloning being introduced. .. This 1003 bp PCR product was extracted from a 1% agarose gel using the TakaraBio gel extraction kit (TakaraBio, #740609.50) and introduced to the cDNA Library Assay:Article Title: Bap180/Baf180 is required to maintain homeostasis of intestinal innate immune response in Drosophila and mice. Article Snippet: Immune homeostasis is a prerequisite to protective immunity against gastrointestinal infections.. In Drosophila, immune deficiency (IMD) signalling (tumour necrosis factor receptor/interleukin-1 receptor, TNFR/IL-1R in mammals) is indispensable for intestinal immunity against invading bacteria.. However, how this local antimicrobial immune response contributes to inflammatory regulation remains poorly defined. |